Wikistrike

Wikistrike

Rien ni personne n'est supérieur à la vérité

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Publié par wikistrike.com sur 28 Février 2022, 08:30am

Catégories : #Santé - psychologie, #Science - technologie - web - recherche

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Depuis plus d’un an, nos « experts de la santé et vérificateurs de faits » de confiance nous disent que les vaccins à ARNm, dont Pfizer et Moderna, ne s’intègrent pas dans l’ADN cellulaire humain. Cependant, une nouvelle étude retentissante publiée dans Current Issues of Molecular Biology montre que les experts de la santé et les vérificateurs de faits avaient tort.

Des études en laboratoire montrent que les vaccins à ARNm s’intègrent dans l’ADN cellulaire humain. En fait, les vaccins modifient votre ADN pour toujours.

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Ce qu’il dit, c’est que des études de laboratoire montrent que le vaccin à ARNm s’intègre effectivement dans l’ADN cellulaire humain. Cela signifie qu’une injection de vaccin Pfizer, même unique, modifie de façon permanente l’ADN des cellules touchées.

Les médias grand public et les vérificateurs de faits se sont consacrés à nous dire le contraire :

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Cependant, un article retentissant paru dans la revue Current Issues of Molecular Biology suggère qu’ils n’ont cessé de diffuser des informations erronées.

Une nouvelle étude est parue : Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Rapport d’IgorChudov :

Ce qu’il dit, c’est que des études de laboratoire montrent que le vaccin ARNm s’intègre effectivement dans l’ADN cellulaire humain. Cela signifie qu’une injection de vaccin Pfizer, prise même une seule fois, modifie de façon permanente l’ADN des cellules touchées.

Cependant, l’article retentissant paru dans Current Issues of Molecular Biology montre le contraire.

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

L’article montre qu’in vitro, en utilisant une lignée de cellules hépatiques humaines, le vaccin ARNm de Pfizer utilise une enzyme transcriptase inverse naturelle appelée LINE-1, et que le code génétique du vaccin est transcrit de manière inverse dans l’ADN.

Il explique également que l’ARNm du vaccin se déplace effectivement vers le foie, qui est l’un des sites privilégiés (les autres sites, comme nous l’avons entendu, sont les ovaires et autres).

Qu’est-ce que cela signifie ? Normalement, nos cellules font le contraire : le noyau cellulaire, où se trouve l’ADN, exprime certains codes d’ADN en fonction des conditions de la cellule et produit un ARN messager naturel et humain. Cet ARN messager sort du noyau, où il est exprimé en protéines nécessaires à la construction de la cellule. C’est ainsi que les organismes en croissance expriment différents programmes génétiques pour faire pousser des cellules musculaires ou cérébrales, etc.

Ce processus est appelé « transcription ».

Pendant de nombreuses années, le dogme central de la biologie moléculaire affirmait que la « transcription inverse » – déplacer le code génétique de l’ARN vers le noyau cellulaire sacré et recoder l’ADN – était impossible. Finalement, les scientifiques ont réalisé qu’elle était possible dans diverses conditions. Par exemple, le virus ARN VIH est capable de le faire et il reprogramme notre ADN pour produire des copies de celui-ci. Le VIH est le virus qui cause le SIDA.

Pour effectuer une transcription inverse, des enzymes appelées « transcriptases inverses » sont nécessaires. L’une d’entre elles s’appelle LINE-1.

Apparemment, selon une étude, le vaccin ARNm de Pfizer fait produire aux cellules cette enzyme LINE-1.

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Après avoir constaté une augmentation de la transcriptase inverse de LINE-1, ils ont testé les altérations de l’ADN, pour s’assurer qu’ils ne captent pas plutôt l’ARN.

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain

Le code génétique qu’ils ont récupéré est :

CGAGGTGGCCAAGAATCTGAACGAGA

GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA

TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT

GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT

TCGACGAGGACGATTCTGAGCCCGTGCTGA

AGGGCGTGAAACTGCACTACACATGATGAC

TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA

GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT

CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Quelqu’un veut faire tourner BLAST dessus ?

Simplifié

Comme je l’ai expliqué en réponse à une question :

Le vaccin ARNm Pfizer modifie notre code génétique qui détermine le fonctionnement de nos organismes, que vous avez hérité de votre maman et papa. Or, votre ADN a été modifié par rapport à ce que votre mère et votre père vous ont donné, en ajoutant une petite « modification » mystérieuse de Pfizer.

Votre organisme agit en fonction du programme de votre ADN, et maintenant, eh bien, le programme a été piraté et modifié par Pfizer.

Le code du cancer

Si l’on considère que la « protéine de pointe » Sars-Cov-2 contient le code du cancer du brevet 9,587,003 de Moderna 2017, il est impératif de découvrir les implications de cette transcription inverse, et de savoir si les vaccinés ont maintenant un code génétique indésirable intégré dans leur ADN.

Il est particulièrement intéressant de savoir si cette transcription inverse induite par l’ARNm affecte la « lignée germinale », comme les ovules et les spermatozoïdes, et si elle affecte également le fœtus des femmes enceintes.

Merci de diffuser largement cet article en raison de son importance pour notre santé publique.

EDIT : Notre astucieux commentateur nous a signalé un post anonyme sur 4chan datant de décembre 2020, bien avant que tout cela ne soit connu. La date nous amène à nous demander si cette personne en savait trop ?

Une nouvelle étude retentissante prouve que le vaccin ARNm de Pfizer modifie de façon permanente l’ADN humain
Pour être informé des derniers articles, inscrivez vous :

Archives

Articles récents